Luke Lady Rover Crypto Dog - Mix of Husky, French Bulldog and Pitbull terrier

Achievements

None
Luke Lady Rover
Nice to meet you! I'm Luke Lady Rover. Virtually, I'll come whenever you call. I'm an avid runner! Outside, inside, all over the place! I just want to run! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 67%
  • Age 42 months
  • Racing Exp 0
  • Husky 82%
  • 0 races
  • Gen 13
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAACACGATCCACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
C
G
A
T
C
C
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4449N444444

Composition

Husky
82%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs French Bulldog
Head Pitbull terrier
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky