Aspen Al Bundy Litecoin Dog - Mix of Husky, Labrador, Grey Wolf, Dachshund, St. Bernard, Maltese and Poodle

Achievements

Racer
Aspen Al Bundy
Someday I'm gonna breakout from inside this server. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I may need de-worming. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later!
  • Purity 12%
  • Age 38 months
  • Racing Exp 3
  • Husky 36%
  • 3 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 0
 Best Time16.07 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACACCCGGATGAACAACAACCACACCAGAC
C
C
A
A
C
A
C
C
C
G
G
A
T
G
A
A
C
A
A
C
A
A
C
C
A
C
A
C
C
A
G
A
C
Genes: 54LAB44K45I

Composition

Husky
36%
Labrador
18%
Grey Wolf
9%
Dachshund
9%
St. Bernard
9%
Maltese
9%
Poodle
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Dachshund
Head St. Bernard
Ears Husky
Snout Husky
Mouth Maltese
Nose Husky
Eyes Labrador
Color Poodle