Alma Amelia Bitcoin Dog - Mix of Husky, French Bulldog and St. Bernard

Achievements

Racer
Alma Amelia
What's up? I'm Alma Amelia. I live in your digital dreams. The place I like most in the world is curled up in my human's bed, hogging all the covers! I don't like running outta pee when there are still so many trees. I slept with a cat and I liked it.
  • Purity 67%
  • Age 38 months
  • Racing Exp 15
  • Husky 82%
  • 2 races
  • Gen 17
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 1 0
 Best Time16.32 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAACACGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
C
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4449B444444

Composition

Husky
82%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -14 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky