Prissy Paddy Crypto Game Dog - Mix of Labrador, Husky, Labrador BK, Shiba Inu, Yorkshire Terrier, St. Bernard and French Bulldog
Prissy Paddy
  • Purity 16%
  • Age 51 days
  • Racing Exp 0
  • Labrador 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Sad & Snaillike

Achievements

None

Bio

I answer to 'Prissy Paddy'. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! Looking for that special tail wag.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAACACCAGCACCACCAGTACCATTATGACGA
C
C
A
A
C
A
C
C
A
G
C
A
C
C
A
C
C
A
G
T
A
C
C
A
T
T
A
T
G
A
C
G
A
Genes: 545655E5FB9

Composition

Labrador
45%
Husky
9%
Labrador BK
9%
Shiba Inu
9%
Yorkshire Terrier
9%
St. Bernard
9%
French Bulldog
9%

Current Energy

Vitality +30 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Labrador
Front Legs Labrador BK
Head Labrador
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Yorkshire Terrier
Eyes St. Bernard
Color French Bulldog