Fabio Finn Crypto Dog - Mix of Poodle, Husky, Yorkshire Terrier, Grey Wolf, Dachshund, Border Collie, Boxer, Maltese and Beagle

Achievements

Racer
Podium Champion
Fabio Finn
I'll lick anything. I like big butts, I cannot lie. I hate not being allowed to hunt treasure in the garbage. It smells so good! In my humble opinion the best toy is one of my human's stinky, old socks.
  • Purity 3%
  • Age 3 months
  • Racing Exp 43
  • Poodle 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 3 2
8 races    Best Time14.92 sec
Rank 78  Racing *** Coins
75.0 % wins (6) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TTACCCGACGGAACATACAACACCGACCTAACA
T
T
A
C
C
C
G
A
C
G
G
A
A
C
A
T
A
C
A
A
C
A
C
C
G
A
C
C
T
A
A
C
A
Genes: FLIA4JGKID4

Composition

Poodle
18%
Husky
18%
Yorkshire Terrier
9%
Grey Wolf
9%
Dachshund
9%
Border Collie
9%
Boxer
9%
Maltese
9%
Beagle
9%

Current Energy

Vitality -22 points
Lunar Effect -10 points

Traits Breakdown

Body Yorkshire Terrier
Tail Grey Wolf
Legs Poodle
Front Legs Dachshund
Head Husky
Ears Border Collie
Snout Boxer
Mouth Maltese
Nose Poodle
Eyes Beagle
Color Husky