Mia Max Payne Crypto Game Dog - Mix of Poodle, Shiba Inu, Maltese, Schnauzer, Labrador, Rottweiler and Labrador BK

Achievements

Racer
Mia Max Payne
I'm Mia Max Payne. What do they call you? I'm all about a hard drive because you can't do anything with a floppy disc. I may need de-worming. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I enjoy crunchy kibble and drinking from toilets.
  • Purity 12%
  • Age 41 months
  • Racing Exp 4
  • Poodle 36%
  • 4 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time15.17 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTAGACACCGACATAGTACCACACGCAGAC
G
A
C
G
T
A
G
A
C
A
C
C
G
A
C
A
T
A
G
T
A
C
C
A
C
A
C
G
C
A
G
A
C
Genes: IEIKICE5H6I

Composition

Poodle
36%
Shiba Inu
18%
Maltese
9%
Schnauzer
9%
Labrador
9%
Rottweiler
9%
Labrador BK
9%

Current Energy

Vitality -60 points
Lunar Effect -2 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Poodle
Front Legs Maltese
Head Poodle
Ears Schnauzer
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes Labrador BK
Color Poodle