Whiz Whitie Crypto Game Dog - Mix of Golder Retriever, Border Collie, Pug, Schnauzer, St. Bernard and Dachshund

Achievements

None
Whiz Whitie
They call me Whiz Whitie. What's your name? I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. Squeaky toys are the best, don't you agree? If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 15%
  • Age 40 months
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAAGAATATACAGAAGATACAGATGAGGA
T
A
C
G
A
A
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
T
G
A
G
G
A
Genes: J28CJ88J8BA

Composition

Golder Retriever
36%
Border Collie
27%
Pug
9%
Schnauzer
9%
St. Bernard
9%
Dachshund
9%

Current Energy

Vitality -21 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes St. Bernard
Color Dachshund