Pee Wee Phoenix Litecoin Dog - Mix of Grey Wolf, Border Collie, Corgi, Golder Retriever, Pug and Schnauzer

Achievements

Racer
Pee Wee Phoenix
The cloud's my neighborhood. Slipping my collar, running off and making my humans worried? Every chance I get. I slept with a cat and I liked it. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 18%
  • Age 42 months
  • Racing Exp 2
  • Grey Wolf 45%
  • 2 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time15.00 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCCCCCCCTACAGACCCGAACCCATACCC
T
A
C
A
G
C
C
C
C
C
C
C
T
A
C
A
G
A
C
C
C
G
A
A
C
C
C
A
T
A
C
C
C
Genes: JOLLJ8L2LCL

Composition

Grey Wolf
45%
Border Collie
18%
Corgi
9%
Golder Retriever
9%
Pug
9%
Schnauzer
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Golder Retriever
Snout Grey Wolf
Mouth Pug
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf