Attila Allie

My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I'm into chasing fast cars, squirrels and my tail. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I'm looking for some ruff play. Wanna bite me?

Purity 5%
Age 43 months
Racing Exp 7

Border Collie 18%
1 races
Gen 0

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats


1 races \| 0 1 0	Best Time	15.57 sec
No rank	Racing	*** Coins
100.0 % wins (1)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: TACCCAAGCTTATACAGAAGACTAGGAATACAC

Genes: J5OFJ88DACH

Composition

Border Collie	18%
Golder Retriever	18%
Labrador	9%
Corgi	9%
Yorkshire Terrier	9%
Beagle	9%
Dachshund	9%
Schnauzer	9%
Rottweiler	9%

Current Energy

Vitality	-29 points
Lunar Effect	-4 points

Traits Breakdown

Body	Border Collie
Tail	Labrador
Legs	Corgi
Front Legs	Yorkshire Terrier
Head	Border Collie
Ears	Golder Retriever
Snout	Golder Retriever
Mouth	Beagle
Nose	Dachshund
Eyes	Schnauzer
Color	Rottweiler