Attila Allie Crypto Dog - Mix of Border Collie, Golder Retriever, Labrador, Corgi, Yorkshire Terrier, Beagle, Dachshund, Schnauzer and Rottweiler

Achievements

Pro Racer
Podium Champion
Attila Allie
My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I'm into chasing fast cars, squirrels and my tail. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I'm looking for some ruff play. Wanna bite me?
  • Purity 5%
  • Age 39 months
  • Racing Exp 69
  • Border Collie 18%
  • 18 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

18 races   |
  • 4 3 1
 Best Time15.57 sec
Rank 81  Racing *** Pts
44.4 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACCCAAGCTTATACAGAAGACTAGGAATACAC
T
A
C
C
C
A
A
G
C
T
T
A
T
A
C
A
G
A
A
G
A
C
T
A
G
G
A
A
T
A
C
A
C
Genes: J5OFJ88DACH

Composition

Border Collie
18%
Golder Retriever
18%
Labrador
9%
Corgi
9%
Yorkshire Terrier
9%
Beagle
9%
Dachshund
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality -29 points
Lunar Effect -10 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Corgi
Front Legs Yorkshire Terrier
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Beagle
Nose Dachshund
Eyes Schnauzer
Color Rottweiler