Carmela Cobra Bitcoin Game Dog - Mix of St. Bernard, Schnauzer, Border Collie, German Shepard and Pug

Achievements

None
Carmela Cobra
How YOU doin'? Carmela Cobra here. I am a proud show dog. I like showing off my perfect coat! My favorite chews are underwear and rawhide...the rawhide lasts longer. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 16%
  • Age 38 months
  • Racing Exp 0
  • St. Bernard 36%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTGATCAATATGATACTGAGAAATAATATGA
T
A
C
T
G
A
T
C
A
A
T
A
T
G
A
T
A
C
T
G
A
G
A
A
A
T
A
A
T
A
T
G
A
Genes: JB7CBJB2CCB

Composition

St. Bernard
36%
Schnauzer
27%
Border Collie
18%
German Shepard
9%
Pug
9%

Current Energy

Vitality -31 points
Lunar Effect +18 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs German Shepard
Front Legs Schnauzer
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth Pug
Nose Schnauzer
Eyes Schnauzer
Color St. Bernard