Bones Butch Crypto Dog - Mix of St. Bernard, German Shepard, Grey Wolf, Border Collie, Shiba Inu and Schnauzer

Achievements

None
Bones Butch
I enjoy chasing my tail around. I hate never catching that damn rabbit in my dreams. My favorite way to relax is to be scratched on my belly. If I can't reach it to clean it myself, it doesn't need cleaning!
  • Purity 13%
  • Age 41 months
  • Racing Exp 0
  • St. Bernard 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATGATCACCCTGATACTGAGTAATATCATGA
T
C
A
T
G
A
T
C
A
C
C
C
T
G
A
T
A
C
T
G
A
G
T
A
A
T
A
T
C
A
T
G
A
Genes: 7B7LBJBEC7B

Composition

St. Bernard
36%
German Shepard
27%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%
Schnauzer
9%

Current Energy

Vitality -10 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Grey Wolf
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth Shiba Inu
Nose Schnauzer
Eyes German Shepard
Color St. Bernard