Zoie Zip Digital Cryptocurrency Dog - Mix of German Shepard, Grey Wolf, Border Collie, Pug, Yorkshire Terrier, Dachshund, Maltese and Schnauzer

Achievements

None
Zoie Zip
Top o' the mornin' to ya! I'm Zoie Zip. I'm into leather...if I have the right partner. I don't like to be ignored. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! Rolling around on the carpet after a bath is my favorite way to dry.
  • Purity 6%
  • Age 41 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAACCCCCCTTATACGGAACCATATCATAC
T
C
A
G
A
A
C
C
C
C
C
C
T
T
A
T
A
C
G
G
A
A
C
C
A
T
A
T
C
A
T
A
C
Genes: 72LLFJAKC7J

Composition

German Shepard
18%
Grey Wolf
18%
Border Collie
18%
Pug
9%
Yorkshire Terrier
9%
Dachshund
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Grey Wolf
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Border Collie
Snout Dachshund
Mouth Maltese
Nose Schnauzer
Eyes German Shepard
Color Border Collie