Jackie Juliet Cryptocurrency Dog - Mix of German Shepard, St. Bernard and Border Collie

Achievements

Racer
Jackie Juliet
Howdy there. I'm Jackie Juliet. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! My turn-offs are rolled up newspapers and loud noises. My humans say I bark too much, but I have a lot to say! I'm hoping to find someone who'll howl at the moon with me.
  • Purity 36%
  • Age 43 months
  • Racing Exp 1
  • German Shepard 55%
  • 1 races
  • Gen 13
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.30 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATGATCATCATGATACTGATCATCATCATGA
T
C
A
T
G
A
T
C
A
T
C
A
T
G
A
T
A
C
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: 7B77BJB777B

Composition

German Shepard
55%
St. Bernard
36%
Border Collie
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs German Shepard
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard

Parents

No Children

Photos