Nitro Napoleon Bitcoin Game Dog - Mix of Pug, Schnauzer, Pitbull terrier, Grey Wolf, Labrador BK, German Shepard, French Bulldog and Dachshund

Achievements

Racer
Nitro Napoleon
I'm having some new data architecture built for me, then I'd like to have you over to my place. If you have fleas or ticks, don't bother. It turns me on when I can show an older dog a new trick. My favorite game is Fetch except I never bring the ball back.
  • Purity 8%
  • Age 41 months
  • Racing Exp 13
  • Pug 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
2 races    Best Time15.70 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGAACCCATAGCAATAGAAGAATCACGAGGA
T
C
C
G
A
A
C
C
C
A
T
A
G
C
A
A
T
A
G
A
A
G
A
A
T
C
A
C
G
A
G
G
A
Genes: N2LC6C2279A

Composition

Pug
27%
Schnauzer
18%
Pitbull terrier
9%
Grey Wolf
9%
Labrador BK
9%
German Shepard
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -40 points
Lunar Effect -6 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Grey Wolf
Front Legs Schnauzer
Head Labrador BK
Ears Schnauzer
Snout Pug
Mouth Pug
Nose German Shepard
Eyes French Bulldog
Color Dachshund