Edsel Eddy Crypto Dog - Mix of Grey Wolf, Corgi, Border Collie, Yorkshire Terrier, St. Bernard and Pitbull terrier

Achievements

Racer
Edsel Eddy
I'm Edsel Eddy. What do they call you? Dragging my butt on the carpet feels so good. My humans should try spending 8 hours a day in a crate! I absolutely love long walks when I can stop and smell the bushes. After introductory sniffing, I like some licking.
  • Purity 18%
  • Age 38 months
  • Racing Exp 9
  • Grey Wolf 45%
  • 3 races
  • Gen 3
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 0
 Best Time14.73 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTTACCCTGAAGCCCCCCCTCCCCCAGCCCC
T
A
C
T
T
A
C
C
C
T
G
A
A
G
C
C
C
C
C
C
C
T
C
C
C
C
C
A
G
C
C
C
C
Genes: JFLBOLLNLOL

Composition

Grey Wolf
45%
Corgi
18%
Border Collie
9%
Yorkshire Terrier
9%
St. Bernard
9%
Pitbull terrier
9%

Current Energy

Vitality -35 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Yorkshire Terrier
Legs Grey Wolf
Front Legs St. Bernard
Head Corgi
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Corgi
Color Grey Wolf