Joe Jasper Bitcoin Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Pitbull terrier and Schnauzer

Achievements

Podium Champion
Master Champion
Pro Racer
Joe Jasper
I was born in the web cloud. I like nibbling on most everything, but I'll bite if you want me to. When my human brushes my coat, I get frisky! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 36%
  • Age 38 months
  • Racing Exp 86
  • Grey Wolf 64%
  • 27 races
  • Gen 4
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

27 races   |
  • 3 3 4
 Best Time15.10 sec
Rank 13  Racing *** Pts
37.0 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCTCCCCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JLLLELLNLCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect -20 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf