Papa Prancer Bitcoin Dog - Mix of Pug, Dachshund, St. Bernard, French Bulldog, Grey Wolf, Yorkshire Terrier, German Shepard, Rottweiler, Golder Retriever, Maltese and Border Collie

Achievements

None
Papa Prancer
My name is Papa Prancer and I'd really like to sniff you. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'm the best at running circle 8's. My favorite place to sleep is under the covers between my humans.
  • Purity 0%
  • Age 5 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGGATGACGACCCTTATCACACAGAACCTAC
G
A
A
G
G
A
T
G
A
C
G
A
C
C
C
T
T
A
T
C
A
C
A
C
A
G
A
A
C
C
T
A
C
Genes: 2AB9LF7H8KJ

Composition

Pug
9%
Dachshund
9%
St. Bernard
9%
French Bulldog
9%
Grey Wolf
9%
Yorkshire Terrier
9%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -55 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Dachshund
Legs St. Bernard
Front Legs French Bulldog
Head Grey Wolf
Ears Yorkshire Terrier
Snout German Shepard
Mouth Rottweiler
Nose Golder Retriever
Eyes Maltese
Color Border Collie