Tanner Tripp Bitcoin Dog - Mix of Grey Wolf, Border Collie, Shiba Inu and Golder Retriever
Tanner Tripp
  • Purity 50%
  • Age 15 days
  • Racing Exp 34
  • Grey Wolf 73%
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 9 races
  • Gen 12
Sad & Tardy

Achievements

Racer
Podium Champion

Bio

Hi! I'm Tanner Tripp! I'm 100% digital, baby. I'm the best at running circle 8's. Fences are just challenges...I don't let them stop me! Little Bow Wow is my favorite musician. I just assume he's a dog... I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 9 races
  • 2 1 1
 Best Time14.97 sec
Rank 41  RacingĀ *** Pts
44.4 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCAGACCCCCCCCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
A
G
A
C
C
C
C
C
C
C
C
C
Genes: JLLLELL8LLL

Composition

Grey Wolf
73%
Border Collie
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality +42 points
Lunar Effect -18 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Golder Retriever
Nose Grey Wolf
Eyes Grey Wolf
Color Grey Wolf

Parents

No Children

Photos

crypto pet race results online pet race podium crypto pet race cryptocurrency doggy race results
Gift