Tony Tailgate Bitcoin Dog - Mix of Pug, Labrador BK and German Shepard

Achievements

None
Tony Tailgate
Hi! I'm Tony Tailgate! I'm 100% digital, baby. I'm the best at running circle 8's. Fences are just challenges...I don't let them stop me! Little Bow Wow is my favorite musician. I just assume he's a dog... I just want a snuggle buddy with a nice, soft coat.
  • Purity 67%
  • Age 3 months
  • Racing Exp 0
  • Pug 82%
  • 0 races
  • Gen 20
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGCATCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
G
C
A
T
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 22267222222

Composition

Pug
82%
Labrador BK
9%
German Shepard
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Labrador BK
Head German Shepard
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug