Tywin Tippy Litecoin Dog - Mix of Labrador, French Bulldog, Corgi, Poodle, Pitbull terrier, Shiba Inu, Husky, Pug, Labrador BK, German Shepard and Rottweiler

Achievements

None
Tywin Tippy
Good day to you! I'm Tywin Tippy! In my digital world, cats aren't the only ones who hack. I hate having to share my food dish... I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACGAAGCGACTCCGTAACAGAAGCATCACAC
C
C
A
C
G
A
A
G
C
G
A
C
T
C
C
G
T
A
A
C
A
G
A
A
G
C
A
T
C
A
C
A
C
Genes: 59OINE4267H

Composition

Labrador
9%
French Bulldog
9%
Corgi
9%
Poodle
9%
Pitbull terrier
9%
Shiba Inu
9%
Husky
9%
Pug
9%
Labrador BK
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -17 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail French Bulldog
Legs Corgi
Front Legs Poodle
Head Pitbull terrier
Ears Shiba Inu
Snout Husky
Mouth Pug
Nose Labrador BK
Eyes German Shepard
Color Rottweiler

Parents

No Children