Jade Jagger Crypto Dog - Mix of Schnauzer, Labrador, Husky, Yorkshire Terrier, Shiba Inu, Pitbull terrier, Poodle, Labrador BK, Corgi, Beagle and Dachshund

Achievements

None
Jade Jagger
Nice to meet you! I'm Jade Jagger. Here in cyberspace, I ain't got much use for a floppy disc. I believe running along the beach to catch a stick can be nearly orgasmic. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I like shaking my fur next to humans right after a good swim!
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATACCAACATTAGTATCCGACGCAAGCCTAGGA
A
T
A
C
C
A
A
C
A
T
T
A
G
T
A
T
C
C
G
A
C
G
C
A
A
G
C
C
T
A
G
G
A
Genes: C54FENI6ODA

Composition

Schnauzer
9%
Labrador
9%
Husky
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Pitbull terrier
9%
Poodle
9%
Labrador BK
9%
Corgi
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -21 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Labrador
Legs Husky
Front Legs Yorkshire Terrier
Head Shiba Inu
Ears Pitbull terrier
Snout Poodle
Mouth Labrador BK
Nose Corgi
Eyes Beagle
Color Dachshund