Prince Parker Cryptocurrency Dog - Mix of Rottweiler, Grey Wolf, Pug, Maltese, Poodle, Corgi, Husky, Golder Retriever and St. Bernard

Achievements

None
Prince Parker
I believe running along the beach to catch a stick can be nearly orgasmic. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I like to work out by digging fresh holes in landscaped yards. I 'm here for something RUFF ;)
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGAAACCCCCCACGACAGCACAAGACCCTGA
C
A
C
G
A
A
A
C
C
C
C
C
C
A
C
G
A
C
A
G
C
A
C
A
A
G
A
C
C
C
T
G
A
Genes: H2KLHIO48LB

Composition

Rottweiler
18%
Grey Wolf
18%
Pug
9%
Maltese
9%
Poodle
9%
Corgi
9%
Husky
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -18 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Maltese
Front Legs Grey Wolf
Head Rottweiler
Ears Poodle
Snout Corgi
Mouth Husky
Nose Golder Retriever
Eyes Grey Wolf
Color St. Bernard