Aldo Addison Cryptocurrency Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Pitbull terrier and Schnauzer
Aldo Addison
  • Purity 36%
  • Age 35 months
  • Racing Exp 42
  • Grey Wolf 64%
  • Gold medal 2 Silver medal 3 Bronze medal 0
  • 10 races
  • Gen 11
Sad & Snaillike

Achievements

Pro Racer
TOP 10 Fastest

Bio

I believe running along the beach to catch a stick can be nearly orgasmic. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I like to work out by digging fresh holes in landscaped yards. I 'm here for something RUFF ;)

Racing Stats

Ran 10 races
  • 2 3 0
 Best Time15.43 sec
Rank 8  RacingĀ *** Pts
50.0% wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCTCCCCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JLLLELLNLCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect +24 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf

Parents

No Children

Photos

online dog race podium crypto doggy racing podium Litecoin dog racing virtual pet racing podium cryptocurrency dog racing results
Gift