Aldo Addison Cryptocurrency Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Pitbull terrier and Schnauzer
Aldo Addison
  • Purity 36%
  • Age 15 days
  • Racing Exp 35
  • Grey Wolf 64%
  • Gold medal 2 Silver medal 2 Bronze medal 0
  • 9 races
  • Gen 11
Sad & Tardy

Achievements

Racer

Bio

I believe running along the beach to catch a stick can be nearly orgasmic. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I like to work out by digging fresh holes in landscaped yards. I 'm here for something RUFF ;)

Racing Stats

Ran 9 races
  • 2 2 0
 Best Time16.30 sec
Rank 68  RacingĀ *** Pts
44.4 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCTCCCCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JLLLELLNLCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality +47 points
Lunar Effect -24 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf

Parents

No Children

Photos

Litecoin dog racing results Litecoin canine race podium virtual dog race photo crypto pet race results
Gift