Tinky Toni Bitcoin Dog - Mix of German Shepard, Dachshund and Shiba Inu

Achievements

None
Tinky Toni
Hey! Call me Tinky Toni. I enjoy mixing it up once in a while by visiting different dog parks. My humans say I slobber too much, but hey, I'm just juicy. I hate not being allowed to hunt treasure in the garbage. It smells so good! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy!
  • Purity 65%
  • Age 4 months
  • Racing Exp 0
  • German Shepard 82%
  • 0 races
  • Gen 20
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGATCATCATCATCATCATCATCAGTATCA
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
T
A
T
C
A
Genes: 7A7777777E7

Composition

German Shepard
82%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Shiba Inu
Color German Shepard