Mack Max Payne Crypto Dog - Mix of Husky, Labrador BK, Dachshund and Rottweiler

Achievements

Racer
Mack Max Payne
I live in cyberspace where you can turn me on. I am on a mission to sniff all the butts in the world. ALL the butts. I don't like having to stay off the furniture. I believe running along the beach to catch a stick can be nearly orgasmic. You scratch my belly and I'll scratch yours ;)
  • Purity 52%
  • Age 41 months
  • Racing Exp 1
  • Husky 73%
  • 1 races
  • Gen 6
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time15.90 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAACAACAGCAGGAACAACACACACAACA
A
C
A
A
C
A
A
C
A
A
C
A
G
C
A
G
G
A
A
C
A
A
C
A
C
A
C
A
C
A
A
C
A
Genes: 44446A44H44

Composition

Husky
73%
Labrador BK
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -4 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Husky
Head Labrador BK
Ears Dachshund
Snout Husky
Mouth Husky
Nose Rottweiler
Eyes Husky
Color Husky