Sideline Shaggy Litecoin Game Dog - Mix of Beagle, German Shepard, Grey Wolf, French Bulldog, Maltese, Poodle, Border Collie, Pitbull terrier and Dachshund

Achievements

None
Sideline Shaggy
I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 3%
  • Age 38 months
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTATCACCCCGAACCCTAGACTACTCCTCAGGA
C
T
A
T
C
A
C
C
C
C
G
A
A
C
C
C
T
A
G
A
C
T
A
C
T
C
C
T
C
A
G
G
A
Genes: D7L9KDIJN7A

Composition

Beagle
18%
German Shepard
18%
Grey Wolf
9%
French Bulldog
9%
Maltese
9%
Poodle
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -45 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Grey Wolf
Front Legs French Bulldog
Head Maltese
Ears Beagle
Snout Poodle
Mouth Border Collie
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund