Tristan Turk Cryptocurrency Dog - Mix of Beagle, Dachshund, Pug, Husky, French Bulldog, Maltese, Corgi, Pitbull terrier and German Shepard

Achievements

Racer
Tristan Turk
In my digital world, cats aren't the only ones who hack. I cry whenever I hear an ambulance siren! Don't bother contacting me if you like cats. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 3%
  • Age 38 months
  • Racing Exp 1
  • Beagle 18%
  • 1 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.67 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGAAACACGAACCCTAAGCGGATCCTCAGGA
C
T
A
G
A
A
A
C
A
C
G
A
A
C
C
C
T
A
A
G
C
G
G
A
T
C
C
T
C
A
G
G
A
Genes: D249KDOAN7A

Composition

Beagle
18%
Dachshund
18%
Pug
9%
Husky
9%
French Bulldog
9%
Maltese
9%
Corgi
9%
Pitbull terrier
9%
German Shepard
9%

Current Energy

Vitality -50 points
Lunar Effect -10 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Husky
Front Legs French Bulldog
Head Maltese
Ears Beagle
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund