Fluffy Fred Digital Cryptocurrency Dog - Mix of Grey Wolf, Maltese, Yorkshire Terrier, German Shepard, Schnauzer, Pitbull terrier and St. Bernard

Achievements

Racer
Fluffy Fred
I love waking up early then indulging in long afternoon naps. I'm not into dog collars, unless you're into S & M. As a designer, I suggest low windows or couch backs next to windows without curtains. The smell of fresh manure to roll in makes me wild.
  • Purity 9%
  • Age 38 months
  • Racing Exp 1
  • Grey Wolf 27%
  • 1 races
  • Gen 1
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.42 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCACCCCCCACCTTAATATTATCCTGAACC
C
C
C
T
C
A
C
C
C
C
C
C
A
C
C
T
T
A
A
T
A
T
T
A
T
C
C
T
G
A
A
C
C
Genes: L7LLKFCFNBK

Composition

Grey Wolf
27%
Maltese
18%
Yorkshire Terrier
18%
German Shepard
9%
Schnauzer
9%
Pitbull terrier
9%
St. Bernard
9%

Current Energy

Vitality 0 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Maltese
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes St. Bernard
Color Maltese