Wally Wags Litecoin Dog - Mix of Grey Wolf, Shiba Inu, Rottweiler, German Shepard, Labrador, Yorkshire Terrier and Corgi

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion
Wally Wags
I'm having some new data architecture built for me, then I'd like to have you over to my place. I like to work out by digging fresh holes in landscaped yards. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I just want to "share a bone"... ;)
  • Purity 11%
  • Age 41 months
  • Racing Exp 478
  • Grey Wolf 27%
  • 97 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 20 31 11
97 races    Best Time13.65 sec
Rank 55  Racing *** Coins
63.9 % wins (62) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCACCCCCCGTACACCACCCATTAAGCGTA
C
C
C
T
C
A
C
C
C
C
C
C
G
T
A
C
A
C
C
A
C
C
C
A
T
T
A
A
G
C
G
T
A
Genes: L7LLEHH5FOE

Composition

Grey Wolf
27%
Shiba Inu
18%
Rottweiler
18%
German Shepard
9%
Labrador
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality -10 points
Lunar Effect +16 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes Corgi
Color Shiba Inu