Papa Pickles Litecoin Dog - Mix of St. Bernard, Rottweiler, German Shepard, Schnauzer, Corgi and Shiba Inu

Achievements

Racer
Papa Pickles
I live in cyberspace. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm looking for some ruff play. Wanna bite me?
  • Purity 20%
  • Age 40 months
  • Racing Exp 1
  • St. Bernard 45%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.93 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGATGACACTCATGACACTGAATAAGCGTA
T
G
A
T
G
A
T
G
A
C
A
C
T
C
A
T
G
A
C
A
C
T
G
A
A
T
A
A
G
C
G
T
A
Genes: BBBH7BHBCOE

Composition

St. Bernard
45%
Rottweiler
18%
German Shepard
9%
Schnauzer
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality -38 points
Lunar Effect +16 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs St. Bernard
Front Legs Rottweiler
Head German Shepard
Ears St. Bernard
Snout Rottweiler
Mouth St. Bernard
Nose Schnauzer
Eyes Corgi
Color Shiba Inu

Parents

No Children

Photos