Smarty Shady Cryptocurrency Dog - Mix of St. Bernard, Poodle, Grey Wolf, Rottweiler, German Shepard, Maltese and Schnauzer
Smarty Shady
  • Purity 14%
  • Age 37 months
  • Racing Exp 153
  • St. Bernard 36%
  • Gold medal 6 Silver medal 10 Bronze medal 1
  • 46 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Master Champion
Podium Champion

Bio

The cloud's my neighborhood. I hate not being allowed to hunt treasure in the garbage. It smells so good! The place I like most in the world is curled up in my human's bed, hogging all the covers! I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 46 races
  • 6 10 1
 Best Time14.53 sec
No rank  RacingĀ *** Pts
37.0 % wins (17) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATGACCCCACTCATGAACCTGAATAGACGAC
T
G
A
T
G
A
C
C
C
C
A
C
T
C
A
T
G
A
A
C
C
T
G
A
A
T
A
G
A
C
G
A
C
Genes: BBLH7BKBCII

Composition

St. Bernard
36%
Poodle
18%
Grey Wolf
9%
Rottweiler
9%
German Shepard
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -23 points
Lunar Effect -14 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Grey Wolf
Front Legs Rottweiler
Head German Shepard
Ears St. Bernard
Snout Maltese
Mouth St. Bernard
Nose Schnauzer
Eyes Poodle
Color Poodle