Obi-Wan Olympia Crypto Game Dog - Mix of St. Bernard, German Shepard, Rottweiler and Schnauzer

Achievements

Racer
Obi-Wan Olympia
My favorite game is Fetch except I never bring the ball back. My human says I'm loyal, intelligent, devoted and affectionate. Sometimes I just have to roll in something dead. You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 52%
  • Age 43 months
  • Racing Exp 1
  • St. Bernard 73%
  • 1 races
  • Gen 6
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time15.22 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGATCACACTGATGATGATGAATATGATGA
T
G
A
T
G
A
T
C
A
C
A
C
T
G
A
T
G
A
T
G
A
T
G
A
A
T
A
T
G
A
T
G
A
Genes: BB7HBBBBCBB

Composition

St. Bernard
73%
German Shepard
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs German Shepard
Front Legs Rottweiler
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose Schnauzer
Eyes St. Bernard
Color St. Bernard