Noob Saibot Nakita Bitcoin Dog - Mix of St. Bernard, Corgi and Labrador

Achievements

Racer
Noob Saibot Nakita
How do you do? I'm Noob Saibot Nakita. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My favorite place in the world is the dog park. So many smells!
  • Purity 65%
  • Age 41 months
  • Racing Exp 1
  • St. Bernard 82%
  • 1 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.92 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGATGAAGCTGATGATGATGACCATGATGA
T
G
A
T
G
A
T
G
A
A
G
C
T
G
A
T
G
A
T
G
A
T
G
A
C
C
A
T
G
A
T
G
A
Genes: BBBOBBBB5BB

Composition

St. Bernard
82%
Corgi
9%
Labrador
9%

Current Energy

Vitality -39 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs St. Bernard
Front Legs Corgi
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose Labrador
Eyes St. Bernard
Color St. Bernard