Dandy Deuce Bitcoin Dog - Mix of Yorkshire Terrier, Corgi, Husky, St. Bernard, Schnauzer, Golder Retriever, Labrador, Poodle and French Bulldog

Achievements

Racer
TOP 10 Fastest
Dandy Deuce
This dawg chases mice in a big data warehouse. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! Spiked dog collars really turn me on.
  • Purity 3%
  • Age 41 months
  • Racing Exp 12
  • Yorkshire Terrier 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
7 races    Best Time15.02 sec
Rank 5  Racing *** Coins
14.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATGAAGCATATTAAGCAGACCAGACCGA
A
C
A
T
T
A
T
G
A
A
G
C
A
T
A
T
T
A
A
G
C
A
G
A
C
C
A
G
A
C
C
G
A
Genes: 4FBOCFO85I9

Composition

Yorkshire Terrier
18%
Corgi
18%
Husky
9%
St. Bernard
9%
Schnauzer
9%
Golder Retriever
9%
Labrador
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality -40 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Corgi
Head Schnauzer
Ears Yorkshire Terrier
Snout Corgi
Mouth Golder Retriever
Nose Labrador
Eyes Poodle
Color French Bulldog