Amy Aubree Litecoin Dog - Mix of Schnauzer, Yorkshire Terrier, Golder Retriever, Labrador and German Shepard

Achievements

Racer
Amy Aubree
What's up? I'm Amy Aubree. I like shaking my fur next to humans right after a good swim! I hate not being allowed to hunt treasure in the garbage. It smells so good! Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I just want a snuggle buddy with a nice, soft coat.
  • Purity 29%
  • Age 38 months
  • Racing Exp 1
  • Schnauzer 55%
  • 1 races
  • Gen 4
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.45 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGATTAATAATAATATTAATAATACCATCAATA
A
G
A
T
T
A
A
T
A
A
T
A
A
T
A
T
T
A
A
T
A
A
T
A
C
C
A
T
C
A
A
T
A
Genes: 8FCCCFCC57C

Composition

Schnauzer
55%
Yorkshire Terrier
18%
Golder Retriever
9%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -57 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Yorkshire Terrier
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Schnauzer
Nose Labrador
Eyes German Shepard
Color Schnauzer