Fawful Fifi Cryptocurrency Game Dog - Mix of Schnauzer, Maltese, Yorkshire Terrier, Labrador and German Shepard

Achievements

None
Fawful Fifi
I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I never knew my father. If you enjoy growling through fences as much as I do, we should get together. I like exploring off leash best. Fun-loving and playful only need apply.
  • Purity 38%
  • Age 42 months
  • Racing Exp 0
  • Schnauzer 64%
  • 0 races
  • Gen 5
Make him happy share it to your friend*
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCATAATAATAATATTAATAATACCATCAATA
A
C
C
A
T
A
A
T
A
A
T
A
A
T
A
T
T
A
A
T
A
A
T
A
C
C
A
T
C
A
A
T
A
Genes: KCCCCFCC57C

Composition

Schnauzer
64%
Maltese
9%
Yorkshire Terrier
9%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -72 points
Lunar Effect -16 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Schnauzer
Nose Labrador
Eyes German Shepard
Color Schnauzer