Kyra Kiki Crypto Dog - Mix of Schnauzer, German Shepard and Golder Retriever

Achievements

Racer
Kyra Kiki
Hey! My name's Kyra Kiki! I hate hiding under the bed during a thunder storm but that's just smart, right? I slept with a cat and I liked it. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I'm the best at running circle 8's.
  • Purity 38%
  • Age 40 months
  • Racing Exp 1
  • Schnauzer 55%
  • 1 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.52 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATCAATAATAATATCAATAATATCATCAATA
A
G
A
T
C
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
T
C
A
T
C
A
A
T
A
Genes: 87CCC7CC77C

Composition

Schnauzer
55%
German Shepard
36%
Golder Retriever
9%

Current Energy

Vitality -63 points
Lunar Effect +10 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose German Shepard
Eyes German Shepard
Color Schnauzer