Ricky Rufus Crypto Dog - Mix of Grey Wolf, Beagle, German Shepard, St. Bernard, Shiba Inu, Pug, Golder Retriever, Yorkshire Terrier and Corgi

Achievements

Racer
Podium Champion
Master Champion
Ricky Rufus
Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I've always wanted to be in commercials and be treated as the star I am!
  • Purity 4%
  • Age 38 months
  • Racing Exp 114
  • Grey Wolf 27%
  • 43 races
  • Gen 2
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

43 races   |
  • 2 2 9
 Best Time15.02 sec
No rank  Racing *** Pts
30.2 % wins (13) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTATCACCCTGAGTAGAACCCAGATTAAGCCCC
C
T
A
T
C
A
C
C
C
T
G
A
G
T
A
G
A
A
C
C
C
A
G
A
T
T
A
A
G
C
C
C
C
Genes: D7LBE2L8FOL

Composition

Grey Wolf
27%
Beagle
9%
German Shepard
9%
St. Bernard
9%
Shiba Inu
9%
Pug
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Grey Wolf
Front Legs St. Bernard
Head Shiba Inu
Ears Pug
Snout Grey Wolf
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Corgi
Color Grey Wolf