Dillon Dash Virtual Crypto Dog - Mix of Grey Wolf, Rottweiler, German Shepard, Border Collie, Golder Retriever, Corgi and Shiba Inu
Dillon Dash
  • Purity 14%
  • Age 35 months
  • Racing Exp 97
  • Grey Wolf 36%
  • Gold medal 1 Silver medal 7 Bronze medal 3
  • 33 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer
Podium Champion
Speed Champion
Master Champion

Bio

I keep my well-built figure with zeros and ones. I really enjoy heavy petting. Sometimes I just have to roll in something dead. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 33 races
  • 1 7 3
 Best Time13.77 sec
Rank 43  RacingĀ *** Pts
33.3 % wins (11) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCTCACCCCCCTACCACCACAGACCCAGCGTA
C
C
C
T
C
A
C
C
C
C
C
C
T
A
C
C
A
C
C
A
C
A
G
A
C
C
C
A
G
C
G
T
A
Genes: L7LLJHH8LOE

Composition

Grey Wolf
36%
Rottweiler
18%
German Shepard
9%
Border Collie
9%
Golder Retriever
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality +15 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Rottweiler
Snout Rottweiler
Mouth Golder Retriever
Nose Grey Wolf
Eyes Corgi
Color Shiba Inu

Parents

No Children

Photos

crypto canine racing crypto doggy racing results crypto doggy racing crypto canine race results Litecoin canine racing results online dog racing Litecoin canine race podium Litecoin canine racing
Gift