Dillon Dash Virtual Crypto Dog - Mix of Grey Wolf, Rottweiler, German Shepard, Border Collie, Golder Retriever, Corgi and Shiba Inu

Achievements

Racer
Podium Champion
Speed Champion
Master Champion
Dillon Dash
I keep my well-built figure with zeros and ones. I really enjoy heavy petting. Sometimes I just have to roll in something dead. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 14%
  • Age 38 months
  • Racing Exp 151
  • Grey Wolf 36%
  • 46 races
  • Gen 6
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

46 races   |
  • 2 11 5
 Best Time13.77 sec
No rank  Racing *** Pts
39.1 % wins (18) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCACCCCCCTACCACCACAGACCCAGCGTA
C
C
C
T
C
A
C
C
C
C
C
C
T
A
C
C
A
C
C
A
C
A
G
A
C
C
C
A
G
C
G
T
A
Genes: L7LLJHH8LOE

Composition

Grey Wolf
36%
Rottweiler
18%
German Shepard
9%
Border Collie
9%
Golder Retriever
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality +15 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Rottweiler
Snout Rottweiler
Mouth Golder Retriever
Nose Grey Wolf
Eyes Corgi
Color Shiba Inu