Nikki Nena Bitcoin Game Dog - Mix of Labrador, Corgi, German Shepard, Husky, Maltese, Dachshund and Yorkshire Terrier
Nikki Nena
  • Purity 10%
  • Age 14 months
  • Racing Exp 17
  • Labrador 36%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 5 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Nikki Nena here, let's shake. I hate bubble baths; mud puddles are more my style. My favorite place to sleep is under the covers between my humans. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 5 races
  • 0 2 0
 Best Time15.08 sec
No rank  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCCAGGACCATTACCAAGC
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
C
A
G
G
A
C
C
A
T
T
A
C
C
A
A
G
C
Genes: 7O45K5A5F5O

Composition

Labrador
36%
Corgi
18%
German Shepard
9%
Husky
9%
Maltese
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -16 points
Lunar Effect -14 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Labrador
Snout Dachshund
Mouth Labrador
Nose Yorkshire Terrier
Eyes Labrador
Color Corgi

Parents

No Children

Photos

cryptocurrency pet racing results Litecoin pet race
Gift