Nikki Nena Bitcoin Game Dog - Mix of Labrador, Corgi, German Shepard, Husky, Maltese, Dachshund and Yorkshire Terrier

Achievements

Podium Champion
Pro Racer
Nikki Nena
Nikki Nena here, let's shake. I hate bubble baths; mud puddles are more my style. My favorite place to sleep is under the covers between my humans. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 10%
  • Age 21 months
  • Racing Exp 41
  • Labrador 36%
  • 12 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 2 2
12 races    Best Time15.08 sec
No rank  Racing *** Coins
41.7 % wins (5) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCCAGGACCATTACCAAGC
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
C
A
G
G
A
C
C
A
T
T
A
C
C
A
A
G
C
Genes: 7O45K5A5F5O

Composition

Labrador
36%
Corgi
18%
German Shepard
9%
Husky
9%
Maltese
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -16 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Labrador
Snout Dachshund
Mouth Labrador
Nose Yorkshire Terrier
Eyes Labrador
Color Corgi