Betsy Beast Digital Cryptocurrency Game Dog - Mix of Labrador, Boxer, Husky, Beagle, Dachshund, Labrador BK, German Shepard and Corgi

Achievements

Pro Racer
Podium Champion
Betsy Beast
Howdy there. I'm Betsy Beast. My AI may be artificial, but at least I'm intelligent. I like it when you're frisky. I'm sick of having my nails clipped, those are to help me dig! I never met a crotch or a butt I didn't like, but I'm just friendly that way. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 11%
  • Age 24 months
  • Racing Exp 68
  • Labrador 36%
  • 16 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 2 3 4
 Best Time14.32 sec
No rank  Racing *** Pts
56.3 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAACACACTACCACCAGGAGCATCACCAAGC
C
C
A
A
A
C
A
C
A
C
T
A
C
C
A
C
C
A
G
G
A
G
C
A
T
C
A
C
C
A
A
G
C
Genes: 5G4D55A675O

Composition

Labrador
36%
Boxer
9%
Husky
9%
Beagle
9%
Dachshund
9%
Labrador BK
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Dachshund
Mouth Labrador BK
Nose German Shepard
Eyes Labrador
Color Corgi