Betsy Beast Digital Cryptocurrency Game Dog - Mix of Labrador, Boxer, Husky, Beagle, Dachshund, Labrador BK, German Shepard and Corgi
Betsy Beast
  • Purity 11%
  • Age 60 months
  • Racing Exp 68
  • Labrador 36%
  • Gold medal 2 Silver medal 3 Bronze medal 4
  • 16 races
  • Gen 0
Ecstatic & Fast

Achievements

Pro Racer
Podium Champion

Bio

Howdy there. I'm Betsy Beast. My AI may be artificial, but at least I'm intelligent. I like it when you're frisky. I'm sick of having my nails clipped, those are to help me dig! I never met a crotch or a butt I didn't like, but I'm just friendly that way. I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 16 races
  • 2 3 4
 Best Time14.32 sec
No rank  RacingĀ *** Pts
56.3% wins (9) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAAACACACTACCACCAGGAGCATCACCAAGC
C
C
A
A
A
C
A
C
A
C
T
A
C
C
A
C
C
A
G
G
A
G
C
A
T
C
A
C
C
A
A
G
C
Genes: 5G4D55A675O

Composition

Labrador
36%
Boxer
9%
Husky
9%
Beagle
9%
Dachshund
9%
Labrador BK
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Dachshund
Mouth Labrador BK
Nose German Shepard
Eyes Labrador
Color Corgi