Pokey Porkchop Digital Cryptocurrency Dog - Mix of Labrador, Dachshund, Husky, Beagle and German Shepard

Achievements

Racer
Pokey Porkchop
Hey there! Baby, call me Pokey Porkchop. They say my bite is worse than my bark. I enjoy mixing it up once in a while by visiting different dog parks. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 29%
  • Age 19 months
  • Racing Exp 23
  • Labrador 55%
  • 7 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 0 1 2
 Best Time15.75 sec
No rank  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGGAACACTACCACCAGGACCATCACCACCA
C
C
A
G
G
A
A
C
A
C
T
A
C
C
A
C
C
A
G
G
A
C
C
A
T
C
A
C
C
A
C
C
A
Genes: 5A4D55A5755

Composition

Labrador
55%
Dachshund
18%
Husky
9%
Beagle
9%
German Shepard
9%

Current Energy

Vitality -33 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Dachshund
Mouth Labrador
Nose German Shepard
Eyes Labrador
Color Labrador

Parents

No Children

Photos

crypto doggy racing online doggy race results crypto dog racing photo