Pokey Porkchop Digital Cryptocurrency Dog - Mix of Labrador, Dachshund, Husky, Beagle and German Shepard
Pokey Porkchop
  • Purity 29%
  • Age 16 months
  • Racing Exp 8
  • Labrador 55%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

Hey there! Baby, call me Pokey Porkchop. They say my bite is worse than my bark. I enjoy mixing it up once in a while by visiting different dog parks. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time16.22 sec
No rank  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGAACACTACCACCAGGACCATCACCACCA
C
C
A
G
G
A
A
C
A
C
T
A
C
C
A
C
C
A
G
G
A
C
C
A
T
C
A
C
C
A
C
C
A
Genes: 5A4D55A5755

Composition

Labrador
55%
Dachshund
18%
Husky
9%
Beagle
9%
German Shepard
9%

Current Energy

Vitality -33 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Dachshund
Mouth Labrador
Nose German Shepard
Eyes Labrador
Color Labrador

Parents

No Children

Photos

online canine racing podium
Gift