Frannie Fuzzy Crypto Dog - Mix of Labrador, Dachshund, German Shepard, Rottweiler, Shiba Inu, Corgi and French Bulldog
Frannie Fuzzy
  • Purity 16%
  • Age 14 months
  • Racing Exp 20
  • Labrador 45%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 3 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Power outages and computer viruses scare me! I never met a leg I didn't want to hump. My human says I'm loyal, intelligent, devoted and affectionate. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I 'm here for something RUFF ;)

Racing Stats

Ran 3 races
  • 1 0 2
 Best Time15.95 sec
No rank  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGACCATCACCACACGTACCAAGCCGACCA
C
C
A
G
G
A
C
C
A
T
C
A
C
C
A
C
A
C
G
T
A
C
C
A
A
G
C
C
G
A
C
C
A
Genes: 5A575HE5O95

Composition

Labrador
45%
Dachshund
9%
German Shepard
9%
Rottweiler
9%
Shiba Inu
9%
Corgi
9%
French Bulldog
9%

Current Energy

Vitality -8 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears Rottweiler
Snout Shiba Inu
Mouth Labrador
Nose Corgi
Eyes French Bulldog
Color Labrador