Meadow Millie Crypto Dog - Mix of Labrador, Dachshund, German Shepard, Shiba Inu, Grey Wolf and Beagle

Achievements

Racer
Meadow Millie
You can access my database anytime with your WiFi. Long or short hair works for me, just no baldies please. Rolling around on the carpet after a bath is my favorite way to dry. I like to work out by digging fresh holes in landscaped yards. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 10%
  • Age 26 months
  • Racing Exp 9
  • Labrador 27%
  • 4 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
4 races    Best Time15.07 sec
No rank  Racing *** Coins
25.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGGACCATCACCATCAGTAGGACCCCTAGGA
C
C
A
G
G
A
C
C
A
T
C
A
C
C
A
T
C
A
G
T
A
G
G
A
C
C
C
C
T
A
G
G
A
Genes: 5A5757EALDA

Composition

Labrador
27%
Dachshund
27%
German Shepard
18%
Shiba Inu
9%
Grey Wolf
9%
Beagle
9%

Current Energy

Vitality -19 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears German Shepard
Snout Shiba Inu
Mouth Dachshund
Nose Grey Wolf
Eyes Beagle
Color Dachshund