Meadow Millie Crypto Dog - Mix of Labrador, Dachshund, German Shepard, Shiba Inu, Grey Wolf and Beagle
Meadow Millie
  • Purity 10%
  • Age 21 months
  • Racing Exp 9
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 4 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

You can access my database anytime with your WiFi. Long or short hair works for me, just no baldies please. Rolling around on the carpet after a bath is my favorite way to dry. I like to work out by digging fresh holes in landscaped yards. I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 4 races
  • 0 0 1
 Best Time15.07 sec
Rank 17  RacingĀ *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGACCATCACCATCAGTAGGACCCCTAGGA
C
C
A
G
G
A
C
C
A
T
C
A
C
C
A
T
C
A
G
T
A
G
G
A
C
C
C
C
T
A
G
G
A
Genes: 5A5757EALDA

Composition

Labrador
27%
Dachshund
27%
German Shepard
18%
Shiba Inu
9%
Grey Wolf
9%
Beagle
9%

Current Energy

Vitality -19 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears German Shepard
Snout Shiba Inu
Mouth Dachshund
Nose Grey Wolf
Eyes Beagle
Color Dachshund