Gibson Grace Litecoin Game Dog - Mix of Labrador, Husky, Beagle, Maltese, Labrador BK, German Shepard and Corgi
Gibson Grace
  • Purity 18%
  • Age 34 months
  • Racing Exp 47
  • Labrador 45%
  • Gold medal 4 Silver medal 0 Bronze medal 2
  • 9 races
  • Gen 1
Sad & Snaillike

Achievements

Racer

Bio

Howdy! I'm Gibson Grace. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. When I can break free, I enjoy exploring my neighborhood without my human. Getting out of a long relationship, not looking for another

Racing Stats

Ran 9 races
  • 4 0 2
 Best Time16.10 sec
No rank  RacingĀ *** Pts
66.7% wins (6) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCACCAACACTACCACCAACCGCATCACCAAGC
C
C
A
C
C
A
A
C
A
C
T
A
C
C
A
C
C
A
A
C
C
G
C
A
T
C
A
C
C
A
A
G
C
Genes: 554D55K675O

Composition

Labrador
45%
Husky
9%
Beagle
9%
Maltese
9%
Labrador BK
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Maltese
Mouth Labrador BK
Nose German Shepard
Eyes Labrador
Color Corgi

Parents

No Children

Photos

online dog racing results Litecoin doggy racing results Litecoin pet racing online pet racing Bitcoin dog racing crypto doggy race
Gift