Zippy Zippy Litecoin Game Dog - Mix of Golder Retriever, Grey Wolf, Pitbull terrier, Husky, Shiba Inu, Corgi, Dachshund, German Shepard, French Bulldog and Pug

Achievements

None
Zippy Zippy
Howdy! I'm Zippy Zippy. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. When I can break free, I enjoy exploring my neighborhood without my human. Getting out of a long relationship, not looking for another
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCCACAAGAGTAAGCGGATCACGAAGAGAA
C
C
C
T
C
C
A
C
A
A
G
A
G
T
A
A
G
C
G
G
A
T
C
A
C
G
A
A
G
A
G
A
A
Genes: LN48EOA7982

Composition

Golder Retriever
18%
Grey Wolf
9%
Pitbull terrier
9%
Husky
9%
Shiba Inu
9%
Corgi
9%
Dachshund
9%
German Shepard
9%
French Bulldog
9%
Pug
9%

Current Energy

Vitality -10 points
Lunar Effect -18 points

Traits Breakdown

Body Grey Wolf
Tail Pitbull terrier
Legs Husky
Front Legs Golder Retriever
Head Shiba Inu
Ears Corgi
Snout Dachshund
Mouth German Shepard
Nose French Bulldog
Eyes Golder Retriever
Color Pug