Slink Sable Bitcoin Dog - Mix of Labrador, Poodle, Golder Retriever, German Shepard, Maltese, Pug, Border Collie, St. Bernard and Corgi

Achievements

Racer
Podium Champion
Master Champion
Slink Sable
Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. Air Bud is definitely my favorite movie. What a role model! It doesn't matter to me which team I play for... I just like tail. I 'm here for something RUFF ;)
  • Purity 5%
  • Age 41 months
  • Racing Exp 124
  • Labrador 18%
  • 36 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 7 5
36 races    Best Time15.47 sec
Rank 22  Racing *** Coins
41.7 % wins (15) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AGACCATCAGACGACCCAACCGAATACTGAAGC
A
G
A
C
C
A
T
C
A
G
A
C
G
A
C
C
C
A
A
C
C
G
A
A
T
A
C
T
G
A
A
G
C
Genes: 857II5K2JBO

Composition

Labrador
18%
Poodle
18%
Golder Retriever
9%
German Shepard
9%
Maltese
9%
Pug
9%
Border Collie
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -24 points
Lunar Effect -14 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs German Shepard
Front Legs Poodle
Head Poodle
Ears Labrador
Snout Maltese
Mouth Pug
Nose Border Collie
Eyes St. Bernard
Color Corgi

Parents

No Children

Photos

Litecoin pet race photo Bitcoin dog racing results crypto canine racing photo Bitcoin dog race crypto canine racing results online doggy racing results online dog racing cryptocurrency doggy racing photo