Slink Sable Bitcoin Dog - Mix of Labrador, Poodle, Golder Retriever, German Shepard, Maltese, Pug, Border Collie, St. Bernard and Corgi
Slink Sable
  • Purity 5%
  • Age 37 months
  • Racing Exp 29
  • Labrador 18%
  • Gold medal 1 Silver medal 0 Bronze medal 3
  • 7 races
  • Gen 0
Neutral & Lazy

Achievements

Racer

Bio

Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. Air Bud is definitely my favorite movie. What a role model! It doesn't matter to me which team I play for... I just like tail. I 'm here for something RUFF ;)

Racing Stats

Ran 7 races
  • 1 0 3
 Best Time15.92 sec
No rank  RacingĀ *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGACCATCAGACGACCCAACCGAATACTGAAGC
A
G
A
C
C
A
T
C
A
G
A
C
G
A
C
C
C
A
A
C
C
G
A
A
T
A
C
T
G
A
A
G
C
Genes: 857II5K2JBO

Composition

Labrador
18%
Poodle
18%
Golder Retriever
9%
German Shepard
9%
Maltese
9%
Pug
9%
Border Collie
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -24 points
Lunar Effect -6 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs German Shepard
Front Legs Poodle
Head Poodle
Ears Labrador
Snout Maltese
Mouth Pug
Nose Border Collie
Eyes St. Bernard
Color Corgi