Bobo Brodie Bitcoin Game Dog - Mix of Husky, Shiba Inu, Maltese, German Shepard, Rottweiler, Schnauzer, Beagle, Golder Retriever and Border Collie

Achievements

None
Bobo Brodie
Howdy! I'm Bobo Brodie. I think hamsters and cats are both over-rated. If you have fleas or ticks, don't bother. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 7%
  • Age 42 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAGTAACCTCACACATACTAAGATACACA
A
C
A
G
T
A
G
T
A
A
C
C
T
C
A
C
A
C
A
T
A
C
T
A
A
G
A
T
A
C
A
C
A
Genes: 4EEK7HCD8J4

Composition

Husky
18%
Shiba Inu
18%
Maltese
9%
German Shepard
9%
Rottweiler
9%
Schnauzer
9%
Beagle
9%
Golder Retriever
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Shiba Inu
Front Legs Maltese
Head German Shepard
Ears Rottweiler
Snout Schnauzer
Mouth Beagle
Nose Golder Retriever
Eyes Border Collie
Color Husky