Steffi Sam Litecoin Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Corgi, Beagle, Labrador BK, Rottweiler and Dachshund

Achievements

None
Steffi Sam
Top o' the mornin' to ya! I'm Steffi Sam. I run exclusively on code. Oh, go ahead. Pet me. I know you want to. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 11%
  • Age 40 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACGAAGCGTAGTACTAGTAGCAGTACACGGA
T
C
A
C
G
A
A
G
C
G
T
A
G
T
A
C
T
A
G
T
A
G
C
A
G
T
A
C
A
C
G
G
A
Genes: 79OEEDE6EHA

Composition

Shiba Inu
36%
German Shepard
9%
French Bulldog
9%
Corgi
9%
Beagle
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail French Bulldog
Legs Corgi
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund