Barker Brittany Crypto Dog - Mix of Shiba Inu, Poodle, French Bulldog, German Shepard and Yorkshire Terrier

Achievements

None
Barker Brittany
Halloween costumes are the worst, I hate 'em! My 'G' spot is under my chin...scratch me there and I'll growl softly. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 16%
  • Age 43 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACGAGTAGACTTAGACGTAGTACGAGTAGAC
T
C
A
C
G
A
G
T
A
G
A
C
T
T
A
G
A
C
G
T
A
G
T
A
C
G
A
G
T
A
G
A
C
Genes: 79EIFIEE9EI

Composition

Shiba Inu
36%
Poodle
27%
French Bulldog
18%
German Shepard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail French Bulldog
Legs Shiba Inu
Front Legs Poodle
Head Yorkshire Terrier
Ears Poodle
Snout Shiba Inu
Mouth Shiba Inu
Nose French Bulldog
Eyes Shiba Inu
Color Poodle