Karma Kirby Crypto Game Dog - Mix of Shiba Inu, Pitbull terrier, Golder Retriever, Corgi, Border Collie, Beagle, Maltese, Labrador BK, Rottweiler and Dachshund

Achievements

Racer
Karma Kirby
A-yo...Call me Karma Kirby. Power outages and computer viruses scare me! My humans say I slobber too much, but hey, I'm just juicy. I like shaking my fur next to humans right after a good swim! As a designer, I suggest low windows or couch backs next to windows without curtains. Just looking to sow some wild oats here...
  • Purity 1%
  • Age 38 months
  • Racing Exp 14
  • Shiba Inu 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 1
 Best Time15.43 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCAGAAGCGTATACCTAACCGCAGTACACGGA
T
C
C
A
G
A
A
G
C
G
T
A
T
A
C
C
T
A
A
C
C
G
C
A
G
T
A
C
A
C
G
G
A
Genes: N8OEJDK6EHA

Composition

Shiba Inu
18%
Pitbull terrier
9%
Golder Retriever
9%
Corgi
9%
Border Collie
9%
Beagle
9%
Maltese
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Corgi
Front Legs Shiba Inu
Head Border Collie
Ears Beagle
Snout Maltese
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund

Parents

Children

Photos

virtual pet race results Litecoin pet race photo