Kernal Kasumi Cryptocurrency Dog - Mix of Shiba Inu, Pitbull terrier, German Shepard, St. Bernard, Poodle, Husky, Grey Wolf and Corgi

Achievements

None
Kernal Kasumi
I've always had a crush on Lassie. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 6%
  • Age 39 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGAGACGTAGTATCCTCAACACCCAGCTCCTCA
T
G
A
G
A
C
G
T
A
G
T
A
T
C
C
T
C
A
A
C
A
C
C
C
A
G
C
T
C
C
T
C
A
Genes: BIEEN74LON7

Composition

Shiba Inu
18%
Pitbull terrier
18%
German Shepard
18%
St. Bernard
9%
Poodle
9%
Husky
9%
Grey Wolf
9%
Corgi
9%

Current Energy

Vitality -66 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Poodle
Legs Shiba Inu
Front Legs Shiba Inu
Head Pitbull terrier
Ears German Shepard
Snout Husky
Mouth Grey Wolf
Nose Corgi
Eyes Pitbull terrier
Color German Shepard