Barclay Banjo Hitter Litecoin Dog - Mix of Golder Retriever, Border Collie, Grey Wolf and Dachshund

Achievements

Racer
Barclay Banjo Hitter
Howdy! I'm Barclay Banjo Hitter. I run exclusively on code. My favorite place to sleep is under the covers between my humans. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I never met a leg I didn't want to hump. I just want to "share a bone"... ;)
  • Purity 52%
  • Age 38 months
  • Racing Exp 6
  • Golder Retriever 73%
  • 1 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.97 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAAGAAGAAGATACCCCAGAAGAGGAAGAAGA
A
G
A
A
G
A
A
G
A
A
G
A
T
A
C
C
C
C
A
G
A
A
G
A
G
G
A
A
G
A
A
G
A
Genes: 8888JL88A88

Composition

Golder Retriever
73%
Border Collie
9%
Grey Wolf
9%
Dachshund
9%

Current Energy

Vitality -11 points
Lunar Effect -26 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Grey Wolf
Snout Golder Retriever
Mouth Golder Retriever
Nose Dachshund
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Photos

Litecoin dog racing results